ID: 993908347_993908353

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 993908347 993908353
Species Human (GRCh38) Human (GRCh38)
Location 5:93649416-93649438 5:93649449-93649471
Sequence CCTTCCTGCATGTGCAGGCTAGC GCAGAAGGCTGCAATTTTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 110} {0: 1, 1: 1, 2: 1, 3: 8, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!