ID: 993908347_993908355

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 993908347 993908355
Species Human (GRCh38) Human (GRCh38)
Location 5:93649416-93649438 5:93649465-93649487
Sequence CCTTCCTGCATGTGCAGGCTAGC TTATTGGCTTAAGGTGTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 110} {0: 1, 1: 0, 2: 3, 3: 11, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!