|
Left Crispr |
Right Crispr |
Crispr ID |
993978866 |
993978869 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:94516955-94516977
|
5:94516976-94516998
|
Sequence |
CCGGGCATGGTAGTGCATGCCTG |
TGTAATCCCAGCTACTTAGGAGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 2524, 1: 109296, 2: 239559, 3: 264215, 4: 478659} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|