|
Left Crispr |
Right Crispr |
| Crispr ID |
993978866 |
993978875 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:94516955-94516977
|
5:94517006-94517028
|
| Sequence |
CCGGGCATGGTAGTGCATGCCTG |
CAGGAGAATCGCTTGAACCCAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 41137, 1: 134699, 2: 211581, 3: 171799, 4: 128801} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|