|
Left Crispr |
Right Crispr |
| Crispr ID |
994015017 |
994015029 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:94955404-94955426
|
5:94955454-94955476
|
| Sequence |
CCAGTGAAACAGAACTGTTCACT |
TGCCGAGTGGTCTTGCTCAGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 81, 2: 206, 3: 443, 4: 653} |
{0: 1, 1: 7, 2: 117, 3: 407, 4: 447} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|