ID: 994038125_994038130

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 994038125 994038130
Species Human (GRCh38) Human (GRCh38)
Location 5:95225956-95225978 5:95226004-95226026
Sequence CCCTATTCCCTAAGAGATGGATG TTTTAAATTTCCACAGGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 104} {0: 1, 1: 0, 2: 6, 3: 62, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!