ID: 994057454_994057460

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 994057454 994057460
Species Human (GRCh38) Human (GRCh38)
Location 5:95434341-95434363 5:95434372-95434394
Sequence CCGCCTACCTTCCTTCTTGTGTT GGCCTTTCTCCAGCAACAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 17, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!