ID: 994072762_994072771

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 994072762 994072771
Species Human (GRCh38) Human (GRCh38)
Location 5:95620592-95620614 5:95620614-95620636
Sequence CCTGGGAACTGCTGGGCGAGCCC CCGCGCGGCCACGGGGGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 178} {0: 1, 1: 0, 2: 2, 3: 3, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!