ID: 994080730_994080742

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 994080730 994080742
Species Human (GRCh38) Human (GRCh38)
Location 5:95706385-95706407 5:95706405-95706427
Sequence CCCCCTTCCCTCCCTTCCTCCTG CTGCTCCAGCCACAAATGGGTGG
Strand - +
Off-target summary {0: 4, 1: 63, 2: 681, 3: 4372, 4: 19938} {0: 2, 1: 0, 2: 1, 3: 15, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!