ID: 994102397_994102402

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 994102397 994102402
Species Human (GRCh38) Human (GRCh38)
Location 5:95908275-95908297 5:95908299-95908321
Sequence CCTGAAAAGGCAGGTACCGTCCC TTTCACAGATGAGAAAACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71} {0: 68, 1: 822, 2: 3801, 3: 9908, 4: 17795}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!