ID: 994102398_994102404

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 994102398 994102404
Species Human (GRCh38) Human (GRCh38)
Location 5:95908291-95908313 5:95908310-95908332
Sequence CCGTCCCCTTTCACAGATGAGAA AGAAAACTGAGGCTTTTAATGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 37, 3: 174, 4: 765} {0: 1, 1: 0, 2: 1, 3: 69, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!