ID: 994102400_994102406

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 994102400 994102406
Species Human (GRCh38) Human (GRCh38)
Location 5:95908296-95908318 5:95908324-95908346
Sequence CCCTTTCACAGATGAGAAAACTG TTTAATGGGATATGCTCAAAGGG
Strand - +
Off-target summary {0: 58, 1: 807, 2: 3532, 3: 9066, 4: 16217} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!