ID: 994106492_994106494

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 994106492 994106494
Species Human (GRCh38) Human (GRCh38)
Location 5:95955245-95955267 5:95955282-95955304
Sequence CCATTTGTTTAACAATCTAGTTA GCCAAATGCCCTTTCTGTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 315} {0: 1, 1: 0, 2: 0, 3: 14, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!