ID: 994106816_994106820

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 994106816 994106820
Species Human (GRCh38) Human (GRCh38)
Location 5:95959068-95959090 5:95959094-95959116
Sequence CCATACAAAGGTAGGAAAACAAA CTCCCTTCTGGGGCCTCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 479} {0: 1, 1: 0, 2: 5, 3: 69, 4: 496}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!