ID: 994162286_994162288

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 994162286 994162288
Species Human (GRCh38) Human (GRCh38)
Location 5:96570171-96570193 5:96570201-96570223
Sequence CCTTAGGAAGAGGACTTGTCTTT CTGTGTGTATGCCATGATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 179} {0: 1, 1: 0, 2: 1, 3: 10, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!