ID: 994164243_994164254

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 994164243 994164254
Species Human (GRCh38) Human (GRCh38)
Location 5:96592221-96592243 5:96592259-96592281
Sequence CCACCCTGTCTCTGCTAGAAATA GGTGTGGTGATGTGCGCCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 105, 3: 813, 4: 2596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!