ID: 994187363_994187369

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 994187363 994187369
Species Human (GRCh38) Human (GRCh38)
Location 5:96830155-96830177 5:96830207-96830229
Sequence CCAGCTGTAAGGATAAACCTAGA CCAGCTTGTGGTCCCCAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94} {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!