ID: 994195613_994195617

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 994195613 994195617
Species Human (GRCh38) Human (GRCh38)
Location 5:96919888-96919910 5:96919902-96919924
Sequence CCCCCATTCTTCACAAGGCCCAT AAGGCCCATTGAGAATTATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 192} {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!