ID: 994199891_994199893

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 994199891 994199893
Species Human (GRCh38) Human (GRCh38)
Location 5:96961245-96961267 5:96961274-96961296
Sequence CCTGTAAGTATGGGAAAGCGGTT AAAATCACCAGACAGAATTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52} {0: 1, 1: 0, 2: 0, 3: 31, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!