ID: 994244574_994244579

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 994244574 994244579
Species Human (GRCh38) Human (GRCh38)
Location 5:97465730-97465752 5:97465761-97465783
Sequence CCAATCTCTTAATTGGATTACTG CTGGAGCCCTTCAAGAATCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 14, 3: 39, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!