ID: 994291369_994291377

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 994291369 994291377
Species Human (GRCh38) Human (GRCh38)
Location 5:98031955-98031977 5:98032000-98032022
Sequence CCAAACCCCAGTAACAGGCCAAG AGTTATCCACAGAAGATGGCAGG
Strand - +
Off-target summary {0: 4, 1: 182, 2: 164, 3: 114, 4: 268} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!