ID: 994320334_994320341

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 994320334 994320341
Species Human (GRCh38) Human (GRCh38)
Location 5:98387314-98387336 5:98387361-98387383
Sequence CCCACAATCACTGCACTTCCCCT CGGTGTTATACTGTGCAGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!