ID: 994320334_994320342

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 994320334 994320342
Species Human (GRCh38) Human (GRCh38)
Location 5:98387314-98387336 5:98387367-98387389
Sequence CCCACAATCACTGCACTTCCCCT TATACTGTGCAGCTGGGAGATGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 28, 3: 77, 4: 351} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!