ID: 994355840_994355846

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 994355840 994355846
Species Human (GRCh38) Human (GRCh38)
Location 5:98793153-98793175 5:98793169-98793191
Sequence CCTGCCGGCCGCCTTTGTGGATG GTGGATGGCACCACCAGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61} {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!