ID: 994385648_994385656

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 994385648 994385656
Species Human (GRCh38) Human (GRCh38)
Location 5:99128324-99128346 5:99128377-99128399
Sequence CCTCATTCTCCTGACCTGTCTCA TACATGGATAAGTTCTTTAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 40, 4: 380} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!