ID: 994420520_994420522

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 994420520 994420522
Species Human (GRCh38) Human (GRCh38)
Location 5:99523929-99523951 5:99523944-99523966
Sequence CCTGCTGCAGCTGTGGCTGAGGC GCTGAGGCCCAGAAATATGAGGG
Strand - +
Off-target summary {0: 18, 1: 2, 2: 5, 3: 200, 4: 3037} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!