ID: 994455227_994455230

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 994455227 994455230
Species Human (GRCh38) Human (GRCh38)
Location 5:99997338-99997360 5:99997352-99997374
Sequence CCTGTGGGCCAAGTGGAGTCTGG GGAGTCTGGTGTTCTGAAACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 26, 4: 177} {0: 1, 1: 0, 2: 0, 3: 13, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!