ID: 994473411_994473414

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 994473411 994473414
Species Human (GRCh38) Human (GRCh38)
Location 5:100238398-100238420 5:100238433-100238455
Sequence CCTTCATTAGTCTGAGGGGGGAT CTGCAGAAGCAGTAGCAGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 7, 2: 71, 3: 144, 4: 495}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!