|
Left Crispr |
Right Crispr |
| Crispr ID |
994501397 |
994501400 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:100583165-100583187
|
5:100583183-100583205
|
| Sequence |
CCTTGTCTTCACGTTGAGTAGGC |
TAGGCTGAAGAGAAGGAGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 30, 2: 76, 3: 79, 4: 120} |
{0: 1, 1: 4, 2: 32, 3: 173, 4: 1148} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|