ID: 994547696_994547701

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 994547696 994547701
Species Human (GRCh38) Human (GRCh38)
Location 5:101187542-101187564 5:101187588-101187610
Sequence CCCCCTTGGAAAGAGCAAAATAG CTTTTATCTGAGAAGGAACATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 24, 4: 208} {0: 1, 1: 0, 2: 4, 3: 20, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!