ID: 994643147_994643150

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 994643147 994643150
Species Human (GRCh38) Human (GRCh38)
Location 5:102435482-102435504 5:102435508-102435530
Sequence CCAAGAAGCAGAAAGGAAAGTCC CTTTGAGTATATAAGGTAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 415} {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!