ID: 994789021_994789028 |
View in Genome Browser |
Spacer: 20 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 994789021 | 994789028 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:104200442-104200464 | 5:104200485-104200507 |
| Sequence | CCACCACCAGCAACAAAAAACAA | GAGAAAACACATCGATTTTGAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 9, 2: 49, 3: 354, 4: 1985} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||