ID: 994791519_994791522

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 994791519 994791522
Species Human (GRCh38) Human (GRCh38)
Location 5:104232610-104232632 5:104232631-104232653
Sequence CCAGGGAGGAAGGCTTTAATAAG AGGTGCTGCAGTGGAAGAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 10, 3: 96, 4: 596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!