ID: 994957093_994957096

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 994957093 994957096
Species Human (GRCh38) Human (GRCh38)
Location 5:106546013-106546035 5:106546050-106546072
Sequence CCCAGTTGCACAGATGGGTCCTT AAGCTGAGACTGCTGCAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 117} {0: 1, 1: 0, 2: 3, 3: 25, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!