ID: 994978861_994978867

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 994978861 994978867
Species Human (GRCh38) Human (GRCh38)
Location 5:106846421-106846443 5:106846445-106846467
Sequence CCAACACTGATCTATTTGTATAT GGAAAAGCCTGGGGTAAAAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 23, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!