ID: 995037773_995037774

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 995037773 995037774
Species Human (GRCh38) Human (GRCh38)
Location 5:107554704-107554726 5:107554726-107554748
Sequence CCAAATACTGTGAGATCAACTTC CACTATCAGTAATAACCCTATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!