ID: 995039016_995039030

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 995039016 995039030
Species Human (GRCh38) Human (GRCh38)
Location 5:107567554-107567576 5:107567598-107567620
Sequence CCATCCACCCACCCCTGCCCCAG ACACCCAAGACTCCCAAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 25, 3: 307, 4: 2306} {0: 1, 1: 0, 2: 0, 3: 11, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!