ID: 995041492_995041497

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 995041492 995041497
Species Human (GRCh38) Human (GRCh38)
Location 5:107593291-107593313 5:107593320-107593342
Sequence CCAGCACAGGACCGGACTTCAGT GCATTCTGTGGCTTTGCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 78} {0: 1, 1: 0, 2: 2, 3: 14, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!