ID: 995083220_995083226

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 995083220 995083226
Species Human (GRCh38) Human (GRCh38)
Location 5:108078302-108078324 5:108078335-108078357
Sequence CCTTTGTCCATCTCTAACAACCT TCTCTCCAAAGGTATCAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 189} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!