ID: 995097764_995097767

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 995097764 995097767
Species Human (GRCh38) Human (GRCh38)
Location 5:108259544-108259566 5:108259559-108259581
Sequence CCACACAGCCTCAGTTAGAAATG TAGAAATGAATATGACTAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 290} {0: 1, 1: 0, 2: 0, 3: 33, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!