ID: 995146659_995146664

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 995146659 995146664
Species Human (GRCh38) Human (GRCh38)
Location 5:108794708-108794730 5:108794741-108794763
Sequence CCACTCTCTCCTGCCATGTAAGA AAAGGCTGCTGCCACACATGTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 66, 3: 511, 4: 1688} {0: 1, 1: 0, 2: 3, 3: 13, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!