|
Left Crispr |
Right Crispr |
| Crispr ID |
995160694 |
995160698 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:108977453-108977475
|
5:108977500-108977522
|
| Sequence |
CCAATGTATTTAATTTAAAAAGT |
TTCAAACCTATGTAGTTCAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 11, 3: 108, 4: 908} |
{0: 1, 1: 35, 2: 435, 3: 828, 4: 1013} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|