ID: 995253543_995253549

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 995253543 995253549
Species Human (GRCh38) Human (GRCh38)
Location 5:110019852-110019874 5:110019885-110019907
Sequence CCAGCACTAGAGTGGGAGAGGAG CAGAGCACTGAGAAGGAGTATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 13, 3: 67, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!