ID: 995269861_995269871

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 995269861 995269871
Species Human (GRCh38) Human (GRCh38)
Location 5:110207867-110207889 5:110207913-110207935
Sequence CCCTCTAGGGGCCCACTGGGACT GCAAACAGGAATGTTGGGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 14, 2: 90, 3: 151, 4: 448}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!