ID: 995280647_995280656

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 995280647 995280656
Species Human (GRCh38) Human (GRCh38)
Location 5:110331758-110331780 5:110331797-110331819
Sequence CCCTTCCCCTTCCACATGTGAGG TAACTGATGAACCAGAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 31, 4: 328} {0: 1, 1: 0, 2: 1, 3: 27, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!