ID: 995290372_995290386

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 995290372 995290386
Species Human (GRCh38) Human (GRCh38)
Location 5:110444374-110444396 5:110444419-110444441
Sequence CCCCCAGTCACTGAGCTCTCCCT ACCATGTAGCCACAGCTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 20, 2: 43, 3: 119, 4: 493} {0: 1, 1: 1, 2: 1, 3: 25, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!