ID: 995297873_995297882

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 995297873 995297882
Species Human (GRCh38) Human (GRCh38)
Location 5:110541023-110541045 5:110541063-110541085
Sequence CCCAACAGGAACAGCTAATACAG ACAAGGATCCTGGTGGTACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159} {0: 1, 1: 2, 2: 3, 3: 16, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!