ID: 995308729_995308737

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 995308729 995308737
Species Human (GRCh38) Human (GRCh38)
Location 5:110687101-110687123 5:110687124-110687146
Sequence CCTTCTGACCTTTCTTCCCCCTG AGAAAAGAAAAATAACTCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 55, 4: 547} {0: 1, 1: 2, 2: 16, 3: 266, 4: 2353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!