ID: 995310687_995310695

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 995310687 995310695
Species Human (GRCh38) Human (GRCh38)
Location 5:110707299-110707321 5:110707348-110707370
Sequence CCCAGCCGATGGCACCATGGCAC AGGGAGAGTGCAGTAACTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 91} {0: 1, 1: 0, 2: 19, 3: 92, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!