ID: 995313460_995313479

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 995313460 995313479
Species Human (GRCh38) Human (GRCh38)
Location 5:110739325-110739347 5:110739370-110739392
Sequence CCTCCACCCCGTACGAAGGCCCC GCGGCGGCGGCAGTGTGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115} {0: 1, 1: 0, 2: 0, 3: 50, 4: 522}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!